Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: nlp-22 is expressed in dynamic fashion in the RIA interneurons. ( a ) mRNA expression during larval development. Expression levels cycle in synchrony with each lethargus stage. Yellow circles depict each lethargus stage, as defined by cessation of feeding of the animals (Biological replicates per time point ≥3, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( b ) nlp-22 expression is increased in response to lin-42 over-expression during the adult stage. (*p<0.05, ** p<0.005, Student’s two-tailed t -Test, Biological replicates per condition ≥5, technical replicates = 2 for each biological replicate; Error bars represent s.e.m.). ( c ) An nlp-22 transcriptional GFP reporter is expressed in the RIA neurons (arrow). Intestinal auto-fluorescence is also observed (arrow head). Scale Bar = 5μM.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Expressing, Over Expression, Two Tailed Test, Fluorescence

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: NLP-22 induces behavioral quiescence. ( a ) Gene and protein structure of nlp-22 including over-expression construct. 2.5 hours after nlp-22 induction, animals show reduced movement ( b ) and feeding ( c ) relative to control animals over-expressing GFP (strain: TJ375). ( c ) Removing the signal sequence, or mutating the KR or FRPG eliminates the ability of NLP-22 to reduce pumping rate (**p<0.0001, Student’s two-tailed t -Test, N≥20). ( d ) Animals over-expressing nlp-22 cease pumping, but recover 9 hours after heat-shock (*p<0.001, **p<0.0001, Fisher’s exact test, N≥20 animals, 2 trials; Error bars represent s.e.m.).

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Over Expression, Construct, Expressing, Sequencing, Two Tailed Test

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: Quiescence induced by nlp-22 OE resembles lethargus quiescence. ( a ) Animals that over-express nlp-22 (strain: NQ251) are less responsive to chemical (1-octanol) and optical (blue light) stimulation than control animals that over-express GFP (strain: TJ375) (**p<0.0001, Student’s two-tailed t -Test, N≥20; Error bars represent s.e.m.). ( b ) Over-expressing nlp-22 via a mild heat shock, such that full quiescence is not induced, results in increased backwards movement. White, dark gray, and light gray denote forward, backwards, and no movement, respectively. The average fraction of time spent moving forward or moving backward in a 120s window for nlp-22 over-expressing animals is significantly different from WT worms (*p<0.001. **p<0.0001, Student’s two-tailed t -Test, N=20). In addition to the bias for backwards motion, nlp-22 over-expressing animals also moved significantly less than WT animals (**p<0.0001, Student’s two-tailed t -Test, N=20).

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Two Tailed Test, Expressing

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: nlp-22 is required for normal quiescence during lethargus. ( a ) Fraction of quiescence in a 10-minute moving window in a wild-type animal, an nlp-22(gk509904) mutant, and an nlp-22 ( gk509904 ) mutant carrying an nlp-22 genomic rescuing transgene. The x-axis is hours from the start of recording in the late third larval stage. ( b ) Quiescence in animals expressing double stranded nlp-22 RNA in the hypodermis and in the RIA neurons. Average quiescence (*p<0.05, **p<0.01, ***p<0.001, Student’s two-tailed t -Test; N≥10, Error bars represent s.e.m.), ( c ) and response latencies to blue light ( d ) during fourth larval stage lethargus (***p<0.001, Student’s two-tailed t -Test; N≥28 animals, Error bars represent s.e.m.).

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Mutagenesis, Expressing, Two Tailed Test

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: NLP-22-induced quiescence requires the protein kinase A subunit KIN-2. Feeding ( a ) and locomotion ( b ) quiescence induced by nlp-22 over-expression is impaired in kin-2 mutants (*p<0.0001, Fisher’s exact test, N>20 animals, 2 trials; Error bars represent s.e.m.). Unfilled bars represent animals of genotype qnIs142 [P hsp-16.2:nlp-22; P hsp-16.2:gfp; P myo-2:mCherry; unc-119 ( + )] and filled bars represent animals of genotype qnIs142; kin-2 ( ce179 )X.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Over Expression

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: NLP-22 is similar to Neuromedin S. ( a ) Alignment of NLP-22 preproprotein with orthologs from four nematode species. High conservation (gray box) is observed in the predicted neuropeptide sequence. ( b ) Amino acid sequence similarities (gray boxes) between NLP-22 and vertebrate Neuromedin S peptides. The preproprotein structure of human Neuromedin S and NLP-22 is also shown. Each has an N-terminal signal sequence and a single, c-terminal peptide. The preproprotein is drawn to scale (Bar = 10 Amino Acids) ( c ) Predicted structures of NLP-22 and of NMS. The conserved GR dipeptide and FRP tripeptide motifs are shown in white.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Sequencing

Journal: Nature communications

Article Title: The neuropeptide NLP-22 regulates a sleep-like state in Caenorhabditis elegans

doi: 10.1038/ncomms3846

Figure Lengend Snippet: Model for role of nlp-22 and RIA in sleep-like quiescence regulation. LIN-42 functions in as yet unidentified larval clock cells to regulate nlp-22 expression as well as other quiescence-regulatory factors. Release of NLP-22 neuropeptide promotes sleep-like behavior via a reduction of protein kinase A (PKA) activity. RIA membrane depolarization (marked with the letter V) results in the release of an unidentified wake-promoting neurotransmitter.

Article Snippet: For nlp - 22 over-expression, the promoter of hsp-16.2 was amplified from the vector pPD49.83 (obtained from Addgene) and fused to the genomic sequence of nlp-22 (+1 to +1451) (where nucleotide number refers to the nucleotide position relative to the start site of translation).

Techniques: Expressing, Activity Assay

Journal: Microbial Cell Factories

Article Title: Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9

doi: 10.1186/s12934-016-0605-5

Figure Lengend Snippet: The plasmids used for this work

Article Snippet: The Cas9 gene from Cas9 expression plasmid (Addgene reference number: 42876), gRNA without N20 (5′- GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT-3′) and its promoter (5′- CTAGGTTTATACATAGGCGAGTACTCTGTTATGGAGTCAGATCT-3′) which were all directly synthetized. pKD46 modular (contains: exo, bet, gam, rep and arabinose operon) was used for plasmid construction as backbone. pCas9 series and pRed_Cas9 series other than pRed_Cas9_recA_Δ poxb 41 and pRed_Cas9_recA_Δ lacZ 41 were assembled with the Gibson method, of which DNA oligo primers were designed with j5 and Device Editor [ ].

Techniques: Derivative Assay

Journal: Microbial Cell Factories

Article Title: Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9

doi: 10.1186/s12934-016-0605-5

Figure Lengend Snippet: The procedure of genome editing with one plasmid and one transformation. The first step is to assemble the editing plasmid. For the second step, the plasmid is transformed into E. coli , followed by plating on LB+ Kan+ 1% (w/v) glucose plate, and grew at 30 °C. For the third step, the resulting strain is grown in LB+ Kan for 2 h before induction with 2 g/L l -arabinose for Cas9 and gRNA expression. After culturing of 6 h, the culture is plated on LB+ Kan+ l -arabinose agar plates. Last step, the temperature sensitive editing plasmid is cured by growing the edited strains at 37 °C overnight

Article Snippet: The Cas9 gene from Cas9 expression plasmid (Addgene reference number: 42876), gRNA without N20 (5′- GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT-3′) and its promoter (5′- CTAGGTTTATACATAGGCGAGTACTCTGTTATGGAGTCAGATCT-3′) which were all directly synthetized. pKD46 modular (contains: exo, bet, gam, rep and arabinose operon) was used for plasmid construction as backbone. pCas9 series and pRed_Cas9 series other than pRed_Cas9_recA_Δ poxb 41 and pRed_Cas9_recA_Δ lacZ 41 were assembled with the Gibson method, of which DNA oligo primers were designed with j5 and Device Editor [ ].

Techniques: Plasmid Preparation, Transformation Assay, Expressing

Journal: Microbial Cell Factories

Article Title: Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9

doi: 10.1186/s12934-016-0605-5

Figure Lengend Snippet: Illustration of modularized assembly strategy. a Editing plasmid modular parts with optimized 4 nt TypeIIS resection enzyme linkers; b maps of fixed backbone modular part1 and part2; c map of assembled pRed_Cas9_recA_Δpoxb300 from modular designed parts

Article Snippet: The Cas9 gene from Cas9 expression plasmid (Addgene reference number: 42876), gRNA without N20 (5′- GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT-3′) and its promoter (5′- CTAGGTTTATACATAGGCGAGTACTCTGTTATGGAGTCAGATCT-3′) which were all directly synthetized. pKD46 modular (contains: exo, bet, gam, rep and arabinose operon) was used for plasmid construction as backbone. pCas9 series and pRed_Cas9 series other than pRed_Cas9_recA_Δ poxb 41 and pRed_Cas9_recA_Δ lacZ 41 were assembled with the Gibson method, of which DNA oligo primers were designed with j5 and Device Editor [ ].

Techniques: Plasmid Preparation

Journal: Microbial Cell Factories

Article Title: Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9

doi: 10.1186/s12934-016-0605-5

Figure Lengend Snippet: Comparison of different methods using CRISPR/Cas9 system

Article Snippet: The Cas9 gene from Cas9 expression plasmid (Addgene reference number: 42876), gRNA without N20 (5′- GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT-3′) and its promoter (5′- CTAGGTTTATACATAGGCGAGTACTCTGTTATGGAGTCAGATCT-3′) which were all directly synthetized. pKD46 modular (contains: exo, bet, gam, rep and arabinose operon) was used for plasmid construction as backbone. pCas9 series and pRed_Cas9 series other than pRed_Cas9_recA_Δ poxb 41 and pRed_Cas9_recA_Δ lacZ 41 were assembled with the Gibson method, of which DNA oligo primers were designed with j5 and Device Editor [ ].

Techniques: Comparison, CRISPR, Transformation Assay, Plasmid Preparation